circad | circRNAs associated with diseases

hsa_circ_006100
Gene		Organism	Human
Genome Locus		Build	hg19
Disease	Gastric Cancer	ICD-10	Gastric Cancer (C16.9)
DBLink	Link to database	PMID	31318114
Experimental Method
Sample Type	Tissue and cell lines	Comparison	Twenty pairs of GC tissue and adjacent non"�tumour tissue
Method for Estimation	Quantitative PCR	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward ATAACAACTGCTCAGAGTGCGA Reverse CTCAGCTTCCTGTAGGATGGTC	Statistics	Fold Change : Upregulated pvalue : <0.05
Citation
Liang, M, Huang, G, Liu, Z, Wang, Q, Yu, Z, Liu, Z, Lin, H, Li, M, Zhou, X, Zheng, Y (2019). Elevated levels of hsa_circ_006100 in gastric cancer promote cell growth and metastasis via miR-195/GPRC5A signalling. Cell Prolif., 52, 5:e12661.